1. Solicitation Number: HHS-NIH-NIDA-SSSA-SBSS-2015-822
2. Title: Genome Editing Testing Services
3. NAICS Code: 541380-Testing Laboratories
4. Description:
This is a Small Business Sources Sought notice. This is NOT a solicitation for proposals, proposal abstracts, or quotations. The purpose of this notice is to obtain information regarding: (1) the availability and capability of qualified small business sources; (2) whether they are small businesses; HUBZone small businesses; service-disabled, veteran-owned small businesses; 8(a) small businesses; veteran-owned small businesses; woman-owned small businesses; or small disadvantaged businesses; and (3) their size classification relative to the North American Industry Classification System (NAICS) code for the proposed acquisition. Your responses to the information requested will assist the Government in determining the appropriate acquisition method, including whether a set-aside is possible. An organization that is not considered a small business under the applicable NAICS code should not submit a response to this notice.
This notice is issued to help determine the availability of qualified companies technically capable of meeting the Government requirement and to determine the method of acquisition. It is not to be construed as a commitment by the Government to issue a solicitation or ultimately award a contract. Responses will not be considered as proposals or quotes. No award will be made as a result of this notice. The Government will NOT be responsible for any costs incurred by the respondents to this notice. This notice is strictly for research and information purposes only.
Background: The National Center for Advancing Translational Sciences (NCATS) is a part of the National Institutes of Health (NIH), which mission it is to catalyze the generation of innovative methods and technologies that will enhance the development, testing and implementation of diagnostics and therapeutics across a wide range of human diseases and conditions.
CRISPR-based reagents are used for the gene specific knockout of genes in cells. They are needed to facilitate our RNAi screening program. This program is conducting genome-wide siRNA screens in collaboration with NIH intramural investigators. This work includes RNAi assay development, screening, and initial follow up. As such, discovering probe molecules that could serve as starting points for therapeutics in rare cancers is of great interest within NCATS. NCATS has several projects that address many aspects of oncology mechanisms and approaches to discovering novel, effective small molecules. Therefore, the NCATS is in need of genome editing testing services for a series of gRNAs.
Purpose and Objectives: The purpose of this requirement is to procure testing services, using genome editing tools, to design 8 gRNAs and clone 65 gRNAs.
Features/Requirements: The testing services will be used to confirm active gene hits identified from primary siRNA screens using the same assays. This is vital to help increase confidence in actives. The requirements for the testing services, using the genome editing tools, include the following:
The following are the requirements of the project:
1. Contractor must use a genome editing tool that will include GFP and puromycin selection markers.
2. Contractor must design 8 gRNAs for target sequence for use with wild type Cas9. The sequences for the following genes are listed below:
Target Gene Full Sequence (PAM and flanking) Sequence to Order
SMG1 CGAATCTTCTTCGGAGGATCACCCGGGAAG TCTTCTTCGGAGGATCACCC
EIF4A3 AAGTGGAATTCGAGACCAGCGAGGAGGTGG GGAATTCGAGACCAGCGAGG
RBM8A TGGCGGACGTGCTAGATCTTCACGAGGCTG GGACGTGCTAGATCTTCACG
MAGOH TCTGCGTTACTACGTGGGGCACAAGGGCAA CGTTACTACGTGGGGCACAA
SMG6 GACTCCTTAAGTAAGCAGGTGCAGCGGCGG CCTTAAGTAAGCAGGTGCAG
CASC3 GGCAGCGCGCTTCGCAAGACACCGAGGACG GCGCGCTTCGCAAGACACCG
OR1G1 TCCTGTTCATGTACTTGGTCACGGTGGCAG GTTCATGTACTTGGTCACGG
ALU CGCCTGTAATCCCAGCACTTTGGGAGGCCG TGTAATCCCAGCACTTTGGG
3. Contractor must clone 65 gRNAs into an all in one plasmid expressing Cas9 and gRNA as well as a selection or fluorescent marker. For every plasmid that contains a particular guide, there must be a fluorescent marker or antibiotic marker that is added to the plasmid so that NCATS can select cells that express the guide either by fluorescence microscopy or by selection pressure using antibiotics.
4. Contractor must provide shipping and handling and deliver the designed and cloned gRNAs within 30 days after Contractor receipt of the purchase order.
5. Contractor must provide certificate of analysis and product inserts in the shipment.
Anticipated period of performance: Delivery is anticipated within 30 days after Contractor's receipt of the purchase order.
Capability statement /information sought. Contractors that believe they possess the ability to provide the requirement should submit documentation of their ability to meet each of the project requirements to the Contract Specialist. The response should directly and specifically state in the, capabilities statement, which project requirements you can supply. Contractors must also provide their Company Name, DUNS Number, Physical Address, Point of Contact, and Size and Type of Business (e.g., 8(a), HubZone, etc.) pursuant to the applicable NAICS code and any other information that may be helpful in developing or finalizing the acquisition requirements.
One (1) copy of the response is required and must be in Microsoft Word or Adobe PDF format using 11-point or 12-point font, 8-1/2" x 11" paper size, with 1" top, bottom, left and right margins, and with single or double spacing.
The information submitted must be must be in and outline format that addresses each of the elements of the project requirement and in the capability statement /information sought paragraphs stated herein. A cover page and an executive summary may be included but is not required.
The response is limited to ten (10) page limit. The 10-page limit does not include the cover page, executive summary, or references, if requested.
The response must include the respondents' technical and administrative points of contact, including names, titles, addresses, telephone and fax numbers, and e-mail addresses.
All responses (capability statements) sent in response to this Small Business Sources Sought Notice must be submitted electronically (via e-mail) to the Contract Specialist. Facsimile responses are NOT accepted.
The response must be submitted to Samantha Kelly, Contract Specialist at e-mail address [email protected].
The response must be received on or before September 8, 2015 at 8:00AM, eastern time.
"Disclaimer and Important Notes: This notice does not obligate the Government to award a contract or otherwise pay for the information provided in response. The Government reserves the right to use information provided by respondents for any purpose deemed necessary and legally appropriate. Any organization responding to this notice should ensure that its response is complete and sufficiently detailed to allow the Government to determine the organization's qualifications to perform the work.
Respondents are advised that the Government is under no obligation to acknowledge receipt of the information received or provide feedback to respondents with respect to any information submitted. After a review of the responses received, a presolicitation synopsis and solicitation may be published in Federal Business Opportunities. However, responses to this notice will not be considered adequate responses to a solicitation.
Confidentiality: No proprietary, classified, confidential, or sensitive information should be included in your response. The Government reserves the right to use any non-proprietary technical information in any resultant solicitation(s)."